• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    Microrna as biomarkers for the diagnosis of lung cancer. Use of the micrornas: mir-146a, mir-122, mir-148a, mir-214, mir-372, mir-let7c, mir-30c, mir-19a, mir-193b, mir-29b and mirna-17 for the diagnosis, classification and/or monitoring of lung cancer, method of obtaining useful data for the diagnosis, classification and/or monitoring of an individual or subject that potentially suffers lung cancer, kit or device, microarray and uses. (Machine-translation by Google Translate, not legally binding)
    公开号:ES2646826A1
    申请号:ES201630628
    申请日:2016-05-13
    公开日:2017-12-18
    发明作者:Antonio RODRÍGUEZ ARIZA；Rosario LÓPEZ PEDRERA；Nuria Barbarroja Puerto；Carlos PÉREZ SÁNCHEZ
    申请人:Universidad de Cordoba；Servicio Andaluz de Salud；
    IPC主号:
    专利说明:

    MicroRNAs as biomarkers for the diagnosis of lung cancer FIELD OF THE INVENTION
    The present invention is within the field of Molecular Biology and Clinical Medicine, and specifically refers to a method of obtaining useful data for the diagnosis, classification and / or monitoring of lung cancer. BACKGROUND OF THE INVENTION
    Lung cancer is one of the leading causes of death in industrialized countries, ranking second only to cardiovascular diseases. Tobacco is the main risk factor, being the cause of 85-90% of all cases. Despite its high incidence and mortality, it has a low prevalence because most cases are detected in late stages, so it would be very important to have diagnostic tests capable of detecting the disease as soon as possible, as well as the type of tumor and its invasiveness to guide treatment.
    The condensation analysis of exhaled breath air is a non-invasive test in which exhaled air enters a refrigeration system to condense. This condensed air contains proteins and microRNAs, which may constitute markers of respiratory pathologies, including lung cancer (Conrad et al., 2008. Gen. Intern. Med. 23 Suppl. 1, 78-84. Doi: 10.1007 / s11606- 007-0411-1).
    There are very few proteomic studies in the condensate of exhaled air, and in the existing ones a relatively low number of proteins have been identified (Gianazza et al., 2004. Am. J. Med. 117 (1), 51-54; Fumagalli et al., 2008. Int. J. Mol. Sci. 13 (11), 13894-13910; Kurova et al., 2009. Clin. Chem. Lab. Med. 47 (6), 706-712; Bloemen et al ., 2009. Proteomics Clin. Appl. 3 (4), 498-504; Chang et al., 2010. Eur. Respir. J. 35 (5), 1182-1215; Bloemen et al., 2010. Biomarkers 15 ( 7), 583-93). Only in two more recent studies (Fumagalli et al., 2012. Int. J. Mol. Sci. 13 (11), 13894-13910 .; Bredberg et al., 2012. Clin. Chem. 58 (2), 431- 440) 44 and 124 different proteins have been identified, respectively. However, both studies analyzed pools of samples, and not individual patients. The vast majority of studies conducted to date are related to asthma or other lung diseases, such as chronic obstructive pulmonary disease (COPD), and only the study by Chang et al., Analyzed


    lung cancer patient samples identifying 20 altered proteins in all samples analyzed (Chang et al., 2010. Eur. Respir. J. 35 (5), 1182-1215).
    MicroRNAs (miRNA or miR) are small RNA molecules, 20-25 nucleotides, non-coding for proteins that regulate posttranscriptional processing of RNA, by pairing bases with their complementary messenger RNA (mRNA), leading to repression of the transcription or degradation of mRNA (Filipowicz et al., 2008. Nature Reviews Genetics, 9 (2), 102-114). Approximately 2500 microRNAs have been identified in the human species, their key participation in the regulation of many cellular processes has been demonstrated and their alteration is associated with the development of different pathologies, especially cancer.
    Recently, the presence of certain microRNAs in the sputum of patients with lung cancer has been detected and has been related to the type of cancer, highlighting its role in the diagnosis of the disease (Xie et al., 2010. Lung Cancer, 67 (2), 170-176; Yu et al., 2010. International Journal of Cancer, 127 (12), 2870-2878). MicroRNAs have also been isolated in exhaled air condensate (Puneet and Faoud, 2013. Journal of Analytical Sciences, Methods and Instrumentation, 3, 17-29). Specifically, high levels of microRNA-21 and microRNA-486 have been found differentially expressed in exhaled air condensate of patients with microcytic lung cancer (Mozonni et al., 2013. Biomarkers., 18 (8), 679-686). BRIEF DESCRIPTION OF THE INVENTION
    A first aspect of the invention relates to the use of microRNA biomarkers: miR-146a, miR-122, miR-148a, miR-214, miR-372, miR-let7c, miR-30c, miR-19a, miR- 193b, miR-29b and miR-17 for the diagnosis, classification and / or monitoring of lung cancer. In
    A second aspect of the invention relates to a method of obtaining useful data for the diagnosis, classification and / or monitoring of an individual or subject potentially suffering from lung cancer, hereafter referred to as the first method of the invention, comprising:
    a) quantify the expression product of the biomarkers miR-146a, miR-122, miR-148a, miR-214, miR-372, miR-let7c, miR-30c, miR-19a, miR-193b, miR-29b and / or miR-17 in a biological sample isolated from said individual. Preferably the biological sample is condensate of exhaled air.


    In a preferred embodiment of this aspect of the invention, the first method of the invention further comprises: b) calculating the A index according to the equation: A = -0.083 + 0.172 * (miR-122 / miR-29b) + 0.009 * ( miR-29b / miR-146) -0.038 * (miR-214 / miR5 146) -0.041 * (miR-193 / miR-146) + 0.004 * (miR-30 / miR-146) + 0.056 * (miR-146 / miR-372),
    c) calculate the index B according to the equation: B = 3,793 -0,501 * (miR-17 / miR-148) + 0.167 * (miR-29b / miR-Letc7c) + 0.278 * (miR-214 / miR-Let7c) - 0.045 * (miR-148 / miR-let7c),
    d) calculate the C index according to the equation: 10 C = 1,417 -0,139 * (miR-17 / miR-214) + 0.05 * (miR-122 / miR-148) + 0.106 * (miR-214 / miR- 148), e) calculate the index D according to the equation: D = 4,372 -0,026 * (miR-17 / miR-214) -0,049 * (miR-122 / miR-214) -0,129 * (miR-29b / miR- 214)
    + 0.022 * (miR-214 / miR-30)
    I
    15 f) calculate the E index according to the equation:
    E = 16.12 -0.630 * (miR-29b / miR-214) + 0.157 * (miR-214 / miR-30),
    assigning in each equation the values of the corresponding biomarkers obtained in step (a).
    A third aspect of the invention relates to a method for classification, diagnosis and
    20 follow-up of lung cancer, hereafter second method of the invention, comprising steps (a) and (b) according to the first method of the invention, and further comprises:
    g) classify the individual of step (a) in the group of individuals with lung cancer when the value of the index A of step (b) is preferably less than 0.88, more preferably less than 0.75, and even more preferably less than 0.579.


    A fourth aspect of the invention relates to a method for the classification, diagnosis and monitoring of lung cancer, hereafter referred to as the third method of the invention, comprising steps (a) and (c) according to the first method of the invention, and also comprises:
    h) classify the individual from step (a) in the group of individuals with non-small cell lung cancer of the adenocarcinoma and non-epidermoid type when the B index value of step (c) is preferably less than 0.91, more preferably less than 0.72, and even more preferably less than 0.50.
    A fifth aspect of the invention relates to a method for the classification, diagnosis and monitoring of lung cancer, hereafter referred to as the fourth method of the invention, comprising steps (a) and (d) according to the first method of the invention, and also comprises:
    i) classify the individual from step (a) in the group of individuals with invasive tumor lung cancer when the C index value of step (d) is preferably greater than 0.30, more preferably greater than 0.39, and even more preferably greater than 0.65.
    A sixth aspect of the invention relates to a method for the classification, diagnosis and monitoring of lung cancer, hereafter referred to as the fifth method of the invention, which comprises steps (a) and (e) according to the first method of the invention, and also comprises:
    j) classify the individual from step (a) in the group of individuals with lung cancer with metastasis when the D index value of step (e) is preferably greater than 0.28, more preferably greater than 0.34, and still more preferably greater than 0.45.
    A seventh aspect of the invention relates to a method for the classification, diagnosis and monitoring of lung cancer, hereafter referred to as the sixth method of the invention, comprising steps (a) and (f) according to the first method of the invention, and also comprises:
    k) classify the individual of step (a) in the group of individuals with stage 4 lung cancer when the value of the E index of step (f) is preferably greater than 0.18, more preferably greater than 0.39, and even more preferably greater than 0.64.
    In a preferred embodiment of any aspect of the invention, the biological sample isolated from step (a) is a sample of exhaled air condensate.


    An eighth aspect of the invention relates to a kit or device, hereafter kit
    or device of the invention, comprising the elements necessary to detect the expression levels of the microRNAs: miR-146a, miR-122, miR-148a, miR-214, miR-372, miR-let7c, miR-30c, miR -19a, miR-193b, miR-29b and miR-17, as defined in the first aspect of the invention.
    In a preferred embodiment of this aspect of the invention, the kit or device of the invention comprises primers, probes and / or antibodies capable of quantifying the expression product of the microRNAs: miR-146a, miR-122, miR-148a, miR- 214, miR-372, miR-let7c, miR-30c, miR-19a, miR-193b, miR-29b and miR-17, and where:
    - primers or primers are polynucleotide sequences of between 10 and 30 base pairs, more preferably between 15 and 25 base pairs, even more preferably between 18 and 22 base pairs, and even more preferably about 20 pairs of bases, which have an identity of at least 80%, more preferably of at least 90%, even more preferably of at least 95%, still much more preferably of at least 98%, and particularly of 100% , with a fragment of the sequences complementary to SEQ ID No.: 1, SEQ ID No.: 2, SEQ ID No.: 3, SEQ ID No.: 4, SEQ ID No.: 5, SEQ ID No.: 6, SEQ ID No.: 7, SEQ ID No.: 8, SEQ ID No.: 9, SEQ ID No.: 10, SEQ ID No.: 11, SEQ ID No.: 12, SEQ ID No.: 13, SEQ ID No.: 14, SEQ ID No.: 15, SEQ ID No.: 16, SEQ ID No.: 17, SEQ ID No.: 18, SEQ ID No.: 19, SEQ ID No.: 20, SEQ ID No.: 21, SEQ ID No.: 22 and / or SEQ ID No.: 23.
    - the probes are polynucleotide sequences of between 80 and 1100 base pairs, more preferably between 100 and 1000 base pairs, and even more preferably between 200 and 500 base pairs, which have an identity of at least 80%, more preferably at least 90%, even more preferably at least 95%, even more preferably at least 98%, and particularly 100%, with a fragment of the sequences complementary to SEQ ID NO: 1, SEQ ID Nº: 2, SEQ ID Nº: 3, SEQ ID Nº: 4, SEQ ID Nº: 5, SEQ ID Nº: 6, SEQ ID Nº: 7, SEQ ID Nº: 8, SEQ ID Nº: 9, SEQ ID No.: 10, SEQ ID No.: 11, SEQ ID No.: 12, SEQ ID No.: 13, SEQ ID No.: 14, SEQ ID No.: 15, SEQ ID No.: 16, SEQ ID No.: 17, SEQ ID Nº: 18, SEQ ID Nº: 19, SEQ ID Nº: 20, SEQ ID Nº: 21, SEQ ID Nº: 22 and / or SEQ ID Nº: 23.
    - The antibodies are capable of binding to a region formed by any of the nucleotide sequences SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID No.: 7, SEQ ID No.: 8, SEQ ID No.: 9, SEQ ID No.: 10, SEQ ID No.: 11, SEQ ID No.: 12, SEQ ID No.: 13, SEQ ID No.: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID


    Nº: 17, SEQ ID Nº: 18, SEQ ID Nº: 19, SEQ ID Nº: 20, SEQ ID Nº: 21, SEQ ID Nº: 22 and / or SEQ ID Nº: 23.
    A ninth aspect of the invention relates to a microarray, hereafter referred to as a microarray of the invention, comprising oligonucleotides or single channel microarrays designed from the nucleotide sequences SEQ ID No.: 1, SEQ ID No.: 2, SEQ ID Nº: 3, SEQ ID Nº: 4, SEQ ID Nº: 5, SEQ ID Nº: 6, SEQ ID Nº: 7, SEQ ID Nº: 8, SEQ ID Nº: 9, SEQ ID Nº: 10, SEQ ID Nº: 11, SEQ ID No.: 12, SEQ ID No.: 13, SEQ ID No.: 14, SEQ ID No.: 15, SEQ ID No.: 16, SEQ ID No.: 17, SEQ ID No.: 18, SEQ ID No.: 19, SEQ ID No.: 20, SEQ ID No.: 21, SEQ ID No.: 22 and / or SEQ ID No.: 23.
    Thus, for example, oligonucleotide sequences can be constructed on the surface of a chip by sequential elongation of a growing chain with a single nucleotide using photolithography. Thus, the oligonucleotides are anchored at the 3 'end by a method of selective activation of nucleotides, protected by a photolabile reagent, by the selective incidence of light through a photomask. The photomask can be physical or virtual.
    Thus, oligonucleotide probes can be between 10 and 100 nucleotides, more preferably, between 20 and 70 nucleotides, and even more preferably, between 24 and 30 nucleotides.
    Synthesis in situ on a solid support (for example, glass) could be done using ink-jet technology, which requires longer probes. The supports could be, but not limited to, filters or membranes of NC or nylon (charged), silicon, or glass slides for microscopes covered with aminosilanes, polylysine, aldehydes or epoxy. The probe is each of the chip samples. The target is the sample to be analyzed: miRNA, messenger RNA, total RNA, a PCR fragment, etc.
    In a preferred embodiment of this aspect of the invention, the microarray of the invention has modified oligonucleotides, as described in the previous aspect of the invention.
    A tenth aspect of the invention relates to the use of the kit or device of the invention or the microarray of the invention, for obtaining useful data for the diagnosis, classification and / or monitoring of an individual or subject potentially suffering from lung cancer. .

    DESCRIPTION OF THE FIGURES
    Figure 1. Box diagram (Tukey) of the mean expression (Ln2-Ct) of each differentially expressed miRNA between control and cancer.
    Figure 2. Cash diagram (Tukey) of the differentially expressed miRNA ratios 5 between control and cancer.
    Figure 3. Combination model of the microRNA ratios that discriminates control cancer and ROC curve.
    Resulting equation = -0.083 + 0.172 * (miR-122 / miR-29b) + 0.009 * (miR-29b / miR-146) -0.038 * (miR-214 / miR-146) -0.041 * (miR-193 / miR -146) + 0.004 * (miR-30 / miR-146) + 0.056 * (miR
    10 146 / miR-372)
    Figure 4. Combination model of the microRNA ratios that discriminate between non-small cell tumor types, Adenocarcinoma and Epidermoid. Resulting equation = 3.793-0.501 * (miR-17 / miR-148) + 0.167 * (miR-29b / miR-Let7c) + 0.278 * (miR-214 / miR-Let7c) 0.045 * (miR-148 / miR-Let7c )
    15 Figure 5. Combination model of the microRNA ratios that discriminate between invasiveness or not of the tumor.
    Resulting equation = 1.417-0.139 * (miR-17 / miR-214) + 0.05 * (miR-122 / miR-148) + 0.106 * (miR
    214 / miR-148)
    Figure 6. Combination model of the microRNA ratios that discriminate between the presence or absence of metastases.
    Resulting equation = 4,372-0,026 * (miR-17 / miR-214) -0,049 * (miR-122 / miR-214) -0,129 * (miR29b / miR-214) + 0,022 * (miR-214 / miR-30)
    Figure 7. Combination model of the microRNA ratios that discriminate between stage 3 and 4 of the tumor.
    25 Resulting equation = 16.12-0.630 * (miR-29b / miR-214) + 0.157 * (miR-214 / miR-372) DETAILED DESCRIPTION OF THE INVENTION
    The authors of the present invention have analyzed the levels of microRNAs in exhaled air samples of patients with lung cancer compared to other healthy patients and with different risk factors. The results indicate that microRNAs


    present in exhaled air can be used as markers of a diagnosis, classification and / or monitoring system of lung cancer.
    BIOMARKERS OF THE INVENTION
    Therefore, a first aspect of the invention relates to the use of microRNA biomarkers: miR-146a, miR-122, miR-148a, miR-214, miR-372, miR-let7c, miR-30c, miR19a, miR -193b, miR-29b and miR-17, or any combination thereof, for the diagnosis, classification and / or monitoring of lung cancer, hereinafter biomarkers of the invention. In a preferred embodiment, the use of microRNAs is simultaneous.
    The biomarkers of the invention can be used simultaneously, separately or in any combination thereof for the diagnosis, classification and / or monitoring of lung cancer.
    In a preferred embodiment of this aspect of the invention, sets of ratios are used between the biomarkers of the invention for the diagnosis, classification and / or monitoring of lung cancer. Preferably, the sets of ratios formed between biomarkers of the invention for the diagnosis, classification and / or monitoring of lung cancer used are:
     miR-122 / miR-29b, miR-29b / miR-146, miR-193 / miR-146, miR-146 / miR-372, miR
    214 / miR-146 and / or miR-30 / miR-146,
     miR-17 / miR-148, miR-29b / miR-let7c, miR-214 / miR-let7c and / or miR-148 / miR-let7c,
     miR-17 / miR-214, miR-122 / miR-148 and / or miR-214 / miR-148,
     miR-17 / miR-214, miR-122 / miR-214, miR-29b / miR-214 and / or miR-214 / miR-30,
     miR-29b / miR-214 and / or miR-214 / miR-372
    The term "microRNA" refers to single stranded RNA approximately 22 nucleotides in length, non-coding for proteins and generated from endogenous transcripts that can form hairpin-shaped structures (Lee et al., 2004. Embo. Journal, 23 (20) , 4051-4060). The microRNAs make up a large family of post-transcriptional regulatory genes that control many cellular and eukaryotic development processes, fulfilling a large number of functions. It is estimated that 30% of all human genes are regulated by mechanisms dependent on microRNAs (Rajewsky N. 2006. Nature Genetics, 38, Suppl: S8-13) and that a single microRNA can regulate about 200 different transcripts that can work in different pathways in the cell (Krek et al., 2005, Nature Genetics, 37 (5), 495-500), as well as the same mRNA can be


    regulated by multiple microRNAs (Cai et al., 2009. Genomics Proteomics Bioinformatics, 7 (4), 147-154).
    The term "cancer" is intended to include any member of a class of diseases characterized by uncontrolled growth of aberrant cells. The term includes all known cancers and neoplastic conditions, characterized as malignant, benign, soft or solid tissue, and cancers of all stages and grades, including premetastatic and postmetastatic cancers. Examples of different types of cancer include lung cancer. As used herein, a "tumor" comprises one or more cancer cells.
    The main types of lung cancer are non-small cell lung cancer (NSCLC) (≈ 85% of all lung cancers) and small cell lung cancer (from English Small cell lung cancer (SCLC)) (≈ 15%). Non-small cell lung cancer can be divided into three large histological subtypes:
    - Squamous cell carcinoma, which accounts for 25 to 30% of NSCLC. This type is usually found near the bronchi, toward the center of the thoracic (chest) cavity. It is also known as squamous cell carcinoma and is usually associated with exposure to tobacco smoke.
    - Adenocarcinoma: makes up 40% of all NSCLC. This type of cancer is usually found in the outermost regions of the lung. There is also a rare form of adenocarcinoma, called bronchoalveolar carcinoma (Bronchioalveolar Carcinoma (BAC)) that is being seen more frequently worldwide. BAC spreads throughout the lung as opposed to other more common types of lung cancer that form unique tumors. The cause of BAC is unknown. Despite showing up in person who smoke, it usually occurs in those who have never smoked.
    - Large Cell Carcinoma: conforms from 10% to 15% of NSCLC. It is fast growing and can appear anywhere in the lung., Lung cancer.
    The treatment for lung cancer is based on the type and stage of the cancer. Treatments, although not limited to us, may include: surgery to remove the tumor, chemotherapy (medications that kill or reduce the size of the tumor) or radiation (x-rays that destroy or damage cancer cells).


    METHODS OF THE INVENTION
    A second aspect of the invention relates to a method of obtaining useful data for the diagnosis, classification and / or monitoring of an individual or subject potentially suffering from lung cancer, hereafter referred to as the first method of the invention, comprising:
    a) obtain an isolated biological sample from an individual,
    a ') quantify the expression product of miR-146a, miR-122, miR-148a, miR-214, miR-372, miR-let7c, miR-30c, miR-19a, miR-193b, miR-29b and / or miR-17,
    or alternatively
    a) quantify the expression product of the biomarkers miR-146a, miR-122, miR-148a, miR-214, miR-372, miR-let7c, miR-30c, miR-19a, miR-193b, miR-29b and / or miR-17 in a biological sample isolated from said individual. Preferably the biological sample is condensate of exhaled air.
    Although the expression product of the 11 microRNAs is preferably quantified simultaneously, in order to obtain useful data for the diagnosis, classification and / or monitoring of an individual or subject potentially suffering from lung cancer, the detection of any of them and, preferably of ratios: miR-122 / miR-29b, miR29b / miR-146, miR-193 / miR-146, miR-146 / miR-372, miR-214 / miR-146, miR-30 / miR-146, miR-17 / miR-148, miR-29b / miR-let7c, miR-214 / miR-let7c, miR-148 / miR-let7c, miR-17 / miR214, miR-122 / miR-148, miR-214 / miR-148, miR-17 / miR-214, miR-122 / miR-214, miR29b / miR-214, miR-214 / miR-30, miR-29b / miR-214 and / or miR-214 / miR- 372 is informative.
    The term "expression product", also called "gene product" refers to the biochemical material, either RNA (for example microRNA) or protein, resulting from the expression of a gene. Sometimes a measure of the amount of gene product is used to infer how active a gene is.
    The quantification of the expression product of the microRNAs, or the detection of the expression of their corresponding genes, can be carried out by any of the methods known in the state of the art. Preferably, the quantification is performed by real-time PCR (Q-RT-PCR).
    The measure of the expression levels of a gene, preferably quantitatively. it is based on a signal that is obtained directly from the transcripts of said genes


    (MRNA, microRNA, etc.), and that is directly correlated with the number of RNA molecules produced by the genes. Said signal - which we can also refer to as an intensity signal - can be obtained, for example, by measuring an intensity value of a chemical or physical property of said products. On the other hand, it could be done by indirect measurement that refers to the measurement obtained from a secondary component or a biological measurement system (for example the measurement of cellular responses, ligands, "labels" or enzymatic reaction products).
    The technique preferably used is the so-called real-time polymerase chain reaction (PCR). According to this technique, using an oligonucleotide, enzymes, primers and buffer solution, an original DNA fragment is exponentially amplified. This technique is carried out in an apparatus called thermocycler that maintains the necessary temperature in each of the stages that make up a cycle. Real-time detection is based on the use of fluorescent markers (probes) that bind to all double stranded DNA sequences formed in the cycles of the PCR reaction. Once the marker binds to the double stranded nucleic acid, it emits a fluorescent signal that is processed in real time (Walter et al., 2002, Science, 296, 557-559). The cycle at which the emission of the fluorescent marker intensity exceeds a certain threshold is called Ct. The expression levels of a microRNA are calculated as
    2-Ct.
    In a preferred embodiment of this aspect of the invention, the first method of the invention further comprises:
    b) calculate the index A according to the equation:
    A = -0.083 + 0.172 * (miR-122 / miR-29b) + 0.009 * (miR-29b / miR-146) -0.038 * (miR-214 / miR146) -0.041 * (miR-193 / miR-146) + 0.004 * (miR-30 / miR-146) + 0.056 * (miR-146 / miR-372)
    c) calculate the index B according to the equation:
    B = 3,793 -0,501 * (miR-17 / miR-148) + 0.167 * (miR-29b / miR-Letc7c) + 0.278 * (miR-214 / miR-Let7c) -0.045 * (miR-148 / miR-let7c )
    d) calculate the C index according to the equation:
    C = 1,417 -0,139 * (miR-17 / miR-214) + 0.05 * (miR-122 / miR-148) + 0.106 * (miR-214 / miR-148)
    e) calculate the index D according to the equation:


    D = 4,372 -0,026 * (miR-17 / miR-214) -0,049 * (miR-122 / miR-214) -0,129 * (miR-29b / miR-214)
    + 0.022 * (miR-214 / miR-30)
    I
    f) calculate the E index according to the equation:
    5 E = 16.12 -0.630 * (miR-29b / miR-214) + 0.157 * (miR-214 / miR-30)
    assigning in each equation the values of the corresponding biomarkers obtained in step (a).
    Thus, for the calculation of the indices of the invention A-E it is necessary to consider that the value of the quotients between the biomarkers of microRNAs (miRX / miRY) is obtained
    10 through log2 (2-CtX / 2-CtY), where miRX or X refers to the microRNA indicated in the numerator and miRY or Y indicated microRNA in the denominator.
    A third aspect of the invention relates to a method for the classification, diagnosis and monitoring of lung cancer, hereafter referred to as the second method of the invention, comprising steps (a) and (b) according to the first method of the invention, and also
    15 includes:
    g) classify the individual of step (a) in the group of individuals with lung cancer when the value of the index A of step (b) is preferably less than 0.88, more preferably less than 0.75, and even more preferably less than 0.579.
    A fourth aspect of the invention relates to a method for classification, diagnosis
    20 and monitoring lung cancer, hereinafter third method of the invention, comprising steps (a) and (c) according to the first method of the invention, and further comprises:
    h) classify the individual from step (a) in the group of individuals with non-small cell lung cancer of the adenocarcinoma and non-epidermoid type when the value of the 25 B index of step (c) is preferably less than 0.91, plus preferably less than 0.72, and
    even more preferably less than 0.50.
    A fifth aspect of the invention relates to a method for the classification, diagnosis and monitoring of lung cancer, hereafter referred to as the fourth method of the invention, comprising steps (a) and (d) according to the first method of the invention, and also
    30 comprises:


    i) classify the individual from step (a) in the group of individuals with invasive tumor lung cancer when the C index value of step (d) is preferably greater than 0.30, more preferably greater than 0.39, and even more preferably greater than 0.65.
    In this report, “invasive cancer or tumor” or “infiltrant” is understood as cancer that spreads beyond the layer of tissue in which it started and grows or progresses in healthy tissues that surround it. It could also be defined as the migration and direct penetration of cancer cells in neighboring tissues.
    A sixth aspect of the invention relates to a method for the classification, diagnosis and monitoring of lung cancer, hereafter referred to as the fifth method of the invention, which comprises steps (a) and (e) according to the first method of the invention, and also comprises:
    j) classify the individual from step (a) in the group of individuals with lung cancer with metastasis when the D index value of step (e) is preferably greater than 0.28, more preferably greater than 0.34, and still more preferably greater than 0.45.
    The term "metastasis" refers to the ability of cancer cells to penetrate the blood and lymph vessels, circulate through them, and establish or grow in normal tissues of another part of the body.
    A seventh aspect of the invention relates to a method for the classification, diagnosis and monitoring of lung cancer, hereafter referred to as the sixth method of the invention, comprising steps (a) and (f) according to the first method of the invention, and also comprises:
    k) classify the individual of step (a) in the group of individuals with stage 4 lung cancer when the value of the E index of step (f) is preferably greater than 0.18, more preferably greater than 0.39, and even more preferably greater than 0.64.
    The "stage or stage" of a cancer describes the degree of spread of the disease. Thus, in stage 1 or T1: the tumor does not measure more than 3 centimeters (cm), has not reached the membranes that surround the lungs (visceral pleura), and does not affect the main branches of the bronchi. In stage 2 or T2, the tumor has one or more of the following characteristics: a) It measures more than 3 cm, but does not measure more than 7 cm, b) It involves a main bronchus, but it is more than 2 cm from the carina (the point where the trachea divides into the left and right main bronchi), c) has grown into the membranes surrounding the lungs (visceral pleura), d) the tumor partially obstructs the pathways


    respiratory, but this has not caused the collapse of the entire lung or the appearance of pneumonia. In stage 3 or T3 the tumor has one or more of the following characteristics: a) its size is larger than 7 cm, b) it has grown to the thickness of the chest wall, the muscle that separates the chest from the abdomen (diaphragm ), the membranes that surround the space between the two lungs (mediastinal pleura), or the membranes of the sac that surrounds the heart (parietal pericardium), c) the cancer grows in a main bronchus and is less than 2 cm from the carina , but does not affect the carina itself, d) has grown into the airways enough to cause the total collapse of a lung or pneumonia in the entire lung or e) two or more separate tumor nodules are present in The same lobe of a lung. A stage 4 or T4 lung tumor has one or more of the following characteristics: a) it has grown into the space between the lungs (mediastinum), the heart, large blood vessels near the heart (such as the aorta) , the trachea, the tube that connects the throat to the stomach (esophagus), the spine or the carina and / or) two or more separate tumor nodules are found in different lobes of the same lung
    In a preferred embodiment of any aspect of the invention, the biological sample isolated from step (a) is a sample of exhaled air condensate.
    An "isolated biological sample" includes, but is not limited to, cells, tissues and / or biological fluids of an organism, obtained by any method known to a person skilled in the art. Preferably, the biological sample isolated from step (a) is condensed from exhaled air.
    The methods of the invention can be developed independently or together, in any combination thereof.
    Steps (a), (b), (c), (d), (e), (f), (g), (h), (i), (j) and / or (k) of the methods described above can be fully or partially automated, for example, by means of a robotic sensor device for the quantification of step (a) or the computerized calculation of any of the indices of steps (b), (c), (d) , (e) and / or (f) or the computerized classification in steps (g), (h), (i), (j) and / or (k).
    KIT OR DEVICE OF THE INVENTION, MICROARRAY OF THE INVENTION AND USES
    An eighth aspect of the invention relates to a kit or device, hereafter kit
    or device of the invention, comprising the elements necessary to detect the expression levels of the microRNAs: miR-146a, miR-122, miR-148a, miR-214, miR-372,


    miR-let7c, miR-30c, miR-19a, miR-193b, miR-29b and miR-17, as these have been defined in the first aspect of the invention.
    In a preferred embodiment of this aspect of the invention, the kit or device of the invention comprises primers, probes and / or antibodies capable of quantifying the expression product of the microRNAs: miR-146a, miR-122, miR-148a, miR- 214, miR-372, miR-let7c, miR-30c, miR-19a, miR-193b, miR-29b and miR-17, and where:
    - primers or primers are polynucleotide sequences of between 10 and 30 base pairs, more preferably between 15 and 25 base pairs, even more preferably between 18 and 22 base pairs, and even more preferably about 20 pairs of bases, which have an identity of at least 80%, more preferably of at least 90%, even more preferably of at least 95%, still much more preferably of at least 98%, and particularly of 100% , with a fragment of the sequences complementary to SEQ ID No.: 1, SEQ ID No.: 2, SEQ ID No.: 3, SEQ ID No.: 4, SEQ ID No.: 5, SEQ ID No.: 6, SEQ ID No.: 7, SEQ ID No.: 8, SEQ ID No.: 9, SEQ ID No.: 10, SEQ ID No.: 11, SEQ ID No.: 12, SEQ ID No.: 13, SEQ ID No.: 14, SEQ ID No.: 15, SEQ ID No.: 16, SEQ ID No.: 17, SEQ ID No.: 18, SEQ ID No.: 19, SEQ ID No.: 20, SEQ ID No.: 21, SEQ ID No.: 22 and / or SEQ ID No.: 23.
    - the probes are polynucleotide sequences of between 80 and 1100 base pairs, more preferably between 100 and 1000 base pairs, and even more preferably between 200 and 500 base pairs, which have an identity of at least 80%, more preferably at least 90%, even more preferably at least 95%, even more preferably at least 98%, and particularly 100%, with a fragment of the sequences complementary to SEQ ID NO: 1, SEQ ID Nº: 2, SEQ ID Nº: 3, SEQ ID Nº: 4, SEQ ID Nº: 5, SEQ ID Nº: 6, SEQ ID Nº: 7, SEQ ID Nº: 8, SEQ ID Nº: 9, SEQ ID No.: 10, SEQ ID No.: 11, SEQ ID No.: 12, SEQ ID No.: 13, SEQ ID No.: 14, SEQ ID No.: 15, SEQ ID No.: 16, SEQ ID No.: 17, SEQ ID Nº: 18, SEQ ID Nº: 19, SEQ ID Nº: 20, SEQ ID Nº: 21, SEQ ID Nº: 22 and / or SEQ ID Nº: 23.
    - The antibodies are capable of binding to a region formed by any of the nucleotide sequences SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID No.: 7, SEQ ID No.: 8, SEQ ID No.: 9, SEQ ID No.: 10, SEQ ID No.: 11, SEQ ID No.: 12, SEQ ID No.: 13, SEQ ID No.: 14, SEQ ID No.: 15, SEQ ID No.: 16, SEQ ID No.: 17, SEQ ID No.: 18, SEQ ID No.: 19, SEQ ID No.: 20, SEQ ID No.: 21, SEQ ID No.: 22 and / or SEQ ID NO: 23.


    In another preferred embodiment of this aspect of the invention, the antibodies are modified. In another preferred embodiment of this aspect of the invention, the antibody is human, humanized or synthetic. In another preferred embodiment, the antibody is monoclonal and / or is labeled with a fluorochrome. Preferably, the fluorochrome is selected from the list comprising Fluorescein (FITC), Tetramethylrodamine and derivatives, Phycoerythrin (PE), PerCP, Cy5, Texas, allophycocyanin, or any combination thereof.
    Table 1. microRNAs of the invention.
    Gene name Gen IDMiRNA nameGene sequenceMiRNA sequence
    microRNA 146 (MIR146A) 406938hsa-miR-146a-5pSEQ ID NO: 1SEQ ID NO: 13
    microRNA 122 (MIR122) 406906hsa-miR122-5pSEQ ID NO: 2SEQ ID NO: 14
    microRNA 148a (MIR148A) 406940hsa-miR148a-3pSEQ ID NO: 3SEQ ID NO: 15
    microRNA 214 (MIR214) 406996hsa-miR214-3pSEQ ID NO: 4SEQ ID NO: 16
    microRNA372 (MIR372) 442917hsa-miR372SEQ ID NO: 5SEQ ID NO: 17
    let-7c microRNA (MIRLET7C) 406885hsa-miRlet7cSEQ ID NO: 6SEQ ID NO: 18
    microRNA 30c (MIR30C) 407031 407032hsa-miR30c-5pSEQ ID NO: 7 SEQ ID NO: 8SEQ ID NO: 19
    microRNA 19A (MIR19A) 406979hsa-miR19a-3pSEQ ID NO: 9SEQ ID NO: 20


    microRNA 193b (MIR193B) 574455hsa-miR193b-3pSEQ ID NO: 10SEQ ID NO: 21
    microRNA 29b1 (MIR29B1) 407024hsa-miR29b-3pSEQ ID NO: 11SEQ ID NO: 22
    microRNA17 (MIR17) 406952hsa-miR17-5pSEQ ID NO: 12SEQ ID NO: 23
    In the context of the present invention, the genes MIR146A, MIR122, MIR148A, MIR214, MIR372, MIRLET7C, MIR30C, MIR19A, MIR193B, MIR29B1 and MIR17 are also defined by a nucleotide or polynucleotide sequence, which constitutes the coding sequence
    5 of the microRNAs collected respectively in the SEQ IDs listed in Table 1, and which would include various variants from:
    a) nucleic acid molecules encoding a microRNA comprising the nucleotide sequence of SEQ ID listed in table 1,
    b) nucleic acid molecules whose complementary hybrid chain with the polynucleotide sequence of a),
    c) nucleic acid molecules whose sequence differs from a) and / or b) due to the degeneracy of the genetic code,
    d) nucleic acid molecules encoding a microRNA comprising the nucleotide sequence with an identity of at least 80%, 90%, 95%, 98% or 99% with
    15 the SEQ IDs shown in table 1, respectively, and in which the microRNA encoded by said nucleic acids possesses the activity and structural characteristics of the microRNAs MIR146A, MIR122, MIR148A, MIR214, MIR372, MIRLET7C, MIR30C, MIR19A, MIR193B , MIR29B1 and MIR17. Among these nucleic acid molecules are those collected in the SEQ IDs indicated in table 1.
    Sequences of the invention:
    SEQ ID NO: 1:


    CCGATGTGTATCCTCAGCTTTGAGAACTGAATTCCATGGGTTGTGTCAGTGTCAGACCT CTGAAATTCAGTTCTTCAGCTGGGATATCTCTGTCATCGT SEQ ID NO: 2: CCTTAGCAGAGCTGTGGAGTGTGACAATGGTGACAATGGTGACAATGGTGTACTAGGGG
    SEQ ID NO: 3: GAGGCAAAGTTCTGAGACACTCCGACTCTGAGTATGATAGAAGTCAGTGCACTACAGAA CTTTGTCTC
    SEQ ID NO: 4:
    10 GGCCTGGCTGGACAGAGTTGTCATGTGTCTGCCTGTCTACACTTGCTGTGCAGAACATC CGCTCACCTGTACAGCAGGCACAGACAGGCAGTCACATGACAACCCAGCCT SEQ ID NO: 5: GTGGGCCTCAAATGTGGAGCGGGGGGGG
    AGCGTCAC
    SEQ ID NO: 6:
    GCATCCGGGTTGAGGTAGTAGGTTGTATGGTTTAGAGTTACACCCTGGGAGTTAACTGT ACAACCTTCTAGCTTTCCTTGGAGC SEQ ID NO: 7:
    20 ACCATGCTGTAGTGTGTGTAAACATCCTACACTCTCAGCTGTGAGCTCAAGGTGGCTGG GAGAGGGTTGT TTACTCCTTCTGCCATGGA
    SEQ ID NO: 8: AGATACTGTAAACATCCTACACTCTCAGCTGTGGAAAGTAAGAAAGCTGGGAGAAGGCT GTTTACTCTTTCT
    25 SEQ ID NO: 9: GCAGTCCTCTGTTAGTTTTGCATAGTTGCACTACAAGAAGAATGTAGTTGTGCAAATCTA TGCAAAACTGATGGTGGCCTGC


    SEQ ID NO: 10:
    GTGGTCTCAGAATCGGGGTTTTGAGGGCGAGATGAGTTTATGTTTTATCCAACTGGCCC TCAAAGTCCCG CTTTTGGGGTCAT SEQ ID NO: 11:
    5 CTTCAGGAAGCTGGTTTCATATGGTGGTTTAGATTTAAATAGTGATTGTCTAGCACCATT TGAAATCAGTGTTCTTGGGGG
    SEQ ID NO: 12: GTCAGAATAATGTCAAAGTGCTTACAGTGCAGGTAGTGATATGTGCATCTACTGCAGTG AAGGCACTTGTAGCATTATGGTGAC
    10 SEQ ID NO: 13: UGAGAACUGAAUUCCAUGGGUU SEQ ID NO: 14: UGGAGUGUGACAAUGGUGUUUG SEQ ID NO: 15:
    15 UCAGUGCACUACAGAACUUUGU SEQ ID NO: 16: ACAGCAGGCACAGACAGGCAGU SEQ ID NO: 17: CCUCAAAUGUGGAGCACUAUUCU
    20 SEQ ID NO: 18: UGAGGUAGUAGGUUGUAUGGUU SEQ ID NO: 19: UGUAAACAUCCUACACUCUCAGC SEQ ID NO: 20:
    25 AGUUUUGCAUAGUUGCACUACA


    SEQ ID NO: 21:
    CGGGGUUUUGAGGGCGAGAUGA
    SEQ ID NO: 22:
    UAGCACCAUUUGAAAUCAGUGUU
    5 SEQ ID NO: 23:
    CAAAGUGCUUACAGUGCAGGUAG
    The kit may also contain, without any limitation, buffers, protein extraction solutions, agents to prevent contamination, inhibitors of protein degradation, etc.
    On the other hand, the kit or device of the invention can include all the supports and containers necessary for its implementation and optimization. Preferably, the kit further comprises instructions for carrying out any of the methods of the invention.
    The kit of the invention may include positive and / or negative controls. The kit can also
    15 contain, without any limitation, buffers, protein extraction solutions, agents to prevent contamination, inhibitors of protein degradation, etc.
    In another preferred embodiment of this aspect of the invention, the kit or device of the invention is a kit of parts, comprising a component A, formed by a device for collecting the sample from step a), and a component B, formed by the elements
    20 necessary to carry out the quantitative analysis in the sample from step a) or any of the methods of the invention.
    In a preferred embodiment the kit or device of the invention comprises oligonucleotides. In another preferred embodiment, the oligonucleotides have modifications in some of their nucleotides, such as, but not limited to, nucleotides having any of
    25 its atoms with a radioactive isotope, usually 32P or tritium, immunologically labeled nucleotides, such as with a digoxigenin molecule, and / or immobilized on a membrane. Several possibilities are known in the state of the art.


    A ninth aspect of the invention relates to a microarray, hereafter referred to as a microarray of the invention, comprising oligonucleotides or single channel microarrays designed from the nucleotide sequences SEQ ID No.: 1, SEQ ID No.: 2, SEQ ID Nº: 3, SEQ ID Nº: 4, SEQ ID Nº: 5, SEQ ID Nº: 6, SEQ ID Nº: 7, SEQ ID Nº: 8, SEQ ID Nº: 9, SEQ ID Nº: 10, SEQ ID Nº: 11, SEQ ID No.: 12, SEQ ID No.: 13, SEQ ID No.: 14, SEQ ID No.: 15, SEQ ID No.: 16, SEQ ID No.: 17, SEQ ID No.: 18, SEQ ID No.: 19, SEQ ID No.: 20, SEQ ID No.: 21, SEQ ID No.: 22 and / or SEQ ID No.: 23.
    Thus, for example, oligonucleotide sequences can be constructed on the surface of a chip by sequential elongation of a growing chain with a single nucleotide using photolithography. Thus, the oligonucleotides are anchored at the 3 'end by a method of selective activation of nucleotides, protected by a photolabile reagent, by the selective incidence of light through a photomask. The photomask can be physical or virtual.
    Thus, oligonucleotide probes can be between 10 and 100 nucleotides, more preferably, between 20 and 70 nucleotides, and even more preferably, between 24 and 30 nucleotides.
    Synthesis in situ on a solid support (for example, glass) could be done using ink-jet technology, which requires longer probes. The supports could be, but not limited to, filters or membranes of NC or nylon (charged), silicon, or glass slides for microscopes covered with aminosilanes, polylysine, aldehydes or epoxy. The probe is each of the chip samples. The target is the sample to be analyzed: miRNA, messenger RNA, total RNA, a PCR fragment, etc.
    In a preferred embodiment of this aspect of the invention, the microarray of the invention has modified oligonucleotides, as described in the previous aspect of the invention.
    A tenth aspect of the invention relates to the use of the kit or device of the invention or the microarray of the invention, for obtaining useful data for the diagnosis, classification and / or monitoring of an individual or subject potentially suffering from lung cancer. .
    The invention also extends to computer programs adapted so that any processing means can implement the methods of the invention. Such programs may have the form of source code, object code, an intermediate source of code and object code, for example, as in partially compiled form, or in any


    another form suitable for use in the implementation of the processes according to the invention. Computer programs also cover cloud applications based on that procedure.
    A eleventh aspect of the invention relates to a computer program comprising program instructions to make a computer carry out the process according to any of the methods of the invention.
    In particular, the invention encompasses computer programs arranged on or within a carrier. The carrier can be any entity or device capable of supporting the program. When the program is incorporated into a signal that can be directly transported by a cable or other device or medium, the carrier may be constituted by said cable or other device or means. As a variant, the carrier could be an integrated circuit in which the program is included, the integrated circuit being adapted to execute, or to be used in the execution of, the corresponding processes.
    For example, the programs could be incorporated into a storage medium, such as a ROM, a CD ROM or a semiconductor ROM, a USB memory, or a magnetic recording medium, for example, a floppy disk or a disk Lasted. Alternatively, the programs could be supported on a transmissible carrier signal. For example, it could be an electrical or optical signal that could be transported through an electrical or optical cable, by radio or by any other means.
    A twelfth aspect of the invention relates to a computer-readable storage medium comprising program instructions capable of having a computer perform the steps of any of the methods of the invention.
    A thirteenth aspect of the invention relates to a transmissible signal comprising program instructions capable of having a computer perform the steps of any of the methods of the invention.
    A "nucleic acid or polynucleotide sequence" may comprise the five bases that appear biologically (adenine, guanine, thymine, cytosine and uracil) and / or bases other than the five that appear biologically. These bases can serve different purposes, for example, to stabilize or destabilize hybridization; to stimulate or inhibit probe degradation; or as junction points for detectable debris or screening debris. For example, a polynucleotide of the invention may contain one or more modified, non-standard, derivatized base moieties, including, but not limited to, N6


    methyl-adenine, N6-tert-butyl-benzyl-adenine, imidazole, substituted imidazoles, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5 (carboxyhydroxymethyl) uracil -carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylkeosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methylladenine, 2-methylguanine, 2-methylguanine -methyladenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylkeosine, 5'methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-wydoso, b-oxoacetic acid, 5-methoxy-acetic acid 2-Thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil (i.e., thymine), uracil-5-oxyacetic acid methyl ester, 3- (3-amino-3 -N-2-carboxypropyl) uracil, (acp3) w, 2,6-diaminopurine, and 5-propyl pyrimidine. Other examples of modified, non-standard, or derivatized base moieties can be found in US Pat. Nos. 6,001,611; 5,955,589; 5,844,106; 5,789,562; 5,750,343; 5,728,525; and 5,679,785. In addition, a nucleic acid or polynucleotide sequence may comprise one or more modified sugar moieties including, but not limited to, arabinose, 2-fluoroarabinous, xylulose, and a hexose.
    The terms "polynucleotide" and "nucleic acid" are used interchangeably herein, referring to polymeric forms of nucleotides of any length, both ribonucleotides (RNA or RNA) and deoxyribonucleotides (DNA or DNA).
    The terms "amino acid sequence", "peptide", "oligopeptide", "polypeptide" and "protein" are used interchangeably herein, and refer to a polymeric form of amino acids of any length, which may be coding or non-coding, Chemically or biochemically modified.
    The present invention means biologically active variant or fragment, those variants or fragments of the indicated peptides that have the same physiological, metabolic or immunological effect, or have the same utility as those described. That is, they are functionally equivalent. Such effects can be determined by conventional methods.
    The term "identity", as used herein, refers to the proportion of identical nucleotides or amino acids between two nucleotide or amino acid sequences that are compared. Sequence comparison methods are known in the state of the art, and include, but are not limited to, the GAG program, including GAP (Devereux et al., Nucleic Acids Research 12: 287 (1984) Genetics Computer Group


    University of Wisconsin, Madison, (Wl); BLAST, BLASTP or BLASTN, and FASTA (Altschul et al., 1999. J. Mol. Biol. 215: 403-410.
    The term "individual" or "subject", as used in the description, refers to an animal, preferably a mammal, and more preferably a human being. The term "individual" in this report is synonymous with "patient", and is not intended to be limiting in any aspect, and may be of any age, sex and physical condition. The individual can be anyone, an individual predisposed to a disease (for example, lung cancer) or an individual suffering from said disease.
    Throughout the description and the claims the word "comprises" and its variants are not intended to exclude other technical characteristics, additives, components or steps. For those skilled in the art, other objects, advantages and features of the invention will be derived partly from the description and partly from the practice of the invention. The following examples and drawings are provided by way of illustration, and are not intended to be limiting of the present invention. EXAMPLE OF THE INVENTION
    The object of this patent is the use of circulating microRNA levels in exhaled air condensate as biomarkers for the detection of lung cancer.
    To this end, RNA was isolated by means of miRNAeasy serum / plasma kit (qiagen) of 200 µl of exhaled air from lower pathways of 127 subjects, divided into 4 groups:
    - Group I: 32 Patients diagnosed with lung cancer with different stages of the disease, from the Oncology service of the Reina Sofía Hospital, Córdoba
    - Group II: 31 Patients diagnosed with COPD from the Pulmonology Service of the Reina Sofía Hospital, Córdoba.
    - Group III: 32 Healthy controls with risk factor, being smokers or former smokers from the Internal Medicine service of Reina Sofía Hospital, Córdoba.
    - Group IV: 32 healthy subjects, from the Internal Medicine Service of the Reina Sofía Hospital, Córdoba.
    The total RNA of the samples including the fraction of the microRNAs was isolated from 200 µl of exhaled condensed air using the QIAzol miRNeasy kit (Qiagen, Valencia, CA, USA). The 200 µl of exhaled air was incubated with 1 ml of QIAzol Lysis Reagent


    (Qiagen) to inhibit the function of RNAse enzymes. The protocol was carried out thoroughly following the manufacturer's recommendations. Finally, the isolated RNA was diluted in 14 µl of RNAse-free water and stored at -80 ° C.
    A PCR array of microRNAs (miScript miRNA PCR array cancer, Quiagen; following the manufacturer's instructions) described in different types of tumors was performed: brain, colon, gastric, head, neck, liver, kidney, lymphoma, pancreatic, prostate, skin , ovary, chest and uterus. With this technique, the expression of 84 microRNAs in exhaled air from the lower airways of a pool of 17 healthy controls and 17 cancer patients (Group I and group IV) was evaluated.
    Once the array was performed and the Cts were obtained, the PCR results were normalized with two different housekeepings:
    - Taking as reference the value of the synthetic microRNA Cel-miRNA-39. -Taking as reference the value of the SNORD68 gene that was expressed constitutively in our samples.
    Relative expression levels were calculated according to the 2-Ct method. Using a 2-Fold change cut-off point, we observed that 40 microRNAs were increased and 9 reduced in cancer samples compared to healthy subjects. The results showed that 11 microRNAs were expressed only in patients with tumor or were increased in cancer; in all of them the times of change of expression regarding the control were greater than 10. Some of these microRNAs have been described in urine and plasma of patients with lung cancer, others have been described in other types of tumors, but none in exhaled air .
    The expression of these 11 microRNAs was validated by RT-PCR independently in each subject of the four groups: cases, controls without risk factor, controls with risk factor and COPD. The 11 microRNAs analyzed were: miR-146a, miR-122, miR148a, miR-214, miR-372, miR-let7c, miR-30c, miR-19a, miR-193b, miR-29b and miR-17.
    To perform the PCRs, the methodology followed is the one that includes TaqMan MicroRNA Assay kit (Applied Biosystem), standardized in our group and the one found in the majority of publications related to microRNAs. The protocol consists of a first retrotranscription (RT) of 11 ng of RNA (quantified in the nanodrop) with specific stem-loop primers of microRNAs, followed by a real-time PCR with specific TaqMan probes for each microRNA that is intended to be amplified.


    Each retrotranscription reaction was performed in 15 µl containing 1.5 µl of 10 X RT buffer 1, 0.2 µl of RNAse inhibitor (20 U / ml), 0.15 µl of 100 mmol / L of "deoxynucleoside triphosphates" , 1 µl of 50 U / µl MultiScribe reverse transcriptase, 1.5 µl of each RT primers (4 miRNA RT primers / RT reaction), 11 ng of RNA and water free of RNAse. The reaction was carried out in a GeneAmp PCR System 9700 thermal cycler (Applied BioSystems) at 16 ° C for 30 minutes, 42 ° C for 30 ° C and 85 ° C 5 minutes. Each preamplification was done with a mixture of 4 probes of 4 microRNAs. Thus we made 3 pre-amplifications to subsequently perform the PCRs of the 11 selected microRNAs.
    Then the preamp reaction was carried out. To do this, 2.5 µl of diluted RT product (2.5 µl in 10 µl of RNAse-free water) was combined with 5 µl of Taqman 2x Master Mix PCR, No AmpErase UNG and 2.5 µl of a pool of 4 primers Taqman miRNA assay (0.2x). The reaction was performed in a GeneAmp PCR System 9700 thermocycler (Applied BioSystems) at 95 ° C for 10 minutes, plus 20 cycles at 95 ° C for 15 seconds and 60 ° C for 4 minutes.
    Subsequently, the preamplification product was diluted in 60 µl of RNAse-free water to proceed to the PCR reaction. 4 µl of this preamp product and combined with 5 µl of Taqman 2x Universal PCR Master Mix, No AmpErase UNG, with 0.5 µl of the first specific 20X Taqman miRNA Assay and 0.5 µl of distilled water. The PCR was performed in the Roche LightCycler 480 thermal cycler at 95 ° C for 10 min, followed by 40 cycles at 95 ° C for 15 s and 60 ° C for 1 min. Expression levels of miRNAs were calculated using the 2-Ct method
    Thus, the PCRs of these 11 microRNAs were carried out in the exhaled air samples from the lower pathways of 127 subjects, the analysis of these results.
    Taking into account the absence of an established method of normalizing expression data of circulating microRNAs, the analysis was carried out taking into account the different models published so far (Mestdagh et al., 2009. Genome Biology, Vol.10, No. 6, PP R6; Boeri et al., 2011. Proceedings of the National Academy of Sciences, Vol. 108, No. 9, PP 3713-3718).
    Using the method of expression normalization using as a housekeeping the average of the miRNAs expressed in all samples (Mestdagh et al., 2009. Genome Biology, Vol. 10, No. 6, PP R6) we find that the levels of miR-29b and miR-146a were differentially expressed significantly in cancer patients with respect to the control group (Figure 1).


    Using a second analysis (Boeri et al., 2011. Proceedings of the National Academy of Sciences, Vol. 108, No. 9, PP 3713-3718), the expression level of each miRNA was calculated
    2-Ct
    by the method of. The different reciprocal ratios were then calculated, considering a single ratio for each pair of miRNAs and expressed as log2. In this way, we found that a 7 microRNA signature composed of microRNAs 122, 29b, 146, 193, 372, 214, 30 generated a series of ratios that were differentially expressed between Control and Cancer (Table 2; Figure 2).
    Table 2. Means and SEM of the differentially expressed miRNA ratios between Control and Cancer
    miR Ratios (Log2) Control (Mean ± SEM)Cancer (Mean ± SEM)P
    miR-122 / miR-29b -1.1 ± 0.4-4.3 ± 1.20.01
    miR-29b / miR-146 7.9 ± 1.112.8 ± 1.30.00
    miR-193 / miR-146 -8.6 ± 1.5-3.6 ± 1.40.02
    miR-146 / miR-372 12.5 ± 1.28.2 ± 1.70.04
    miR-214 / miR-146 -12.2 ± 1.5-8.1 ± 1.40.03
    miR-30 / miR-146 2 ± 1.35.4 ± 1.20.05
    Likewise, we generated a model that integrated the combination of differentially expressed ratios (binary logistic regression), which was able to discriminate cancer patients with controls with 80% Specificity, 70% Sensitivity and an area under the curve of 0.76. This model fits the data of
    15 microRNAs in our cohort of individuals. Validation would be necessary in another independent patient cohort (Figure 3).
    On the other hand, we found that within the cancer group, there were different microRNA signatures whose ratios were associated with certain clinical characteristics of patients with lung cancer such as tumor type, invasion, metastasis and stage.
    20 Types of Tumor
    A signature of 5 microRNAs composed of miR-17, -29b, -214, -148 and -let7c generated ratios that were significantly differentially expressed between the adenocarcinoma and epidermoid cancer subtypes (Table 3):


    Table 3. Mean and SEM of the differentially expressed miRNA ratios between the adenocarcinoma and epidermoid tumor subtype
    miR Ratios (Log2) Adenocarcinoma (Mean ± SEM)Epidermoid (Mean ± SEM)P
    miR-17 / miR-148 16.4 ± 1.69.7 ± 3.050.05
    miR-29b / miR-let7c 15.9 ± 2.122.7 ± 1.60.02
    miR-214 / miR-let7c -7.1 ± 1.91.5 ± 2.80.01
    miR-148 / miR-let7c -6.4 ± 2.22.6 ± 2.60.01
    The combination model of these ratios allowed to discriminate the type of tumor
    5 Epidermoid adenocarcioma with a Specificity of 91%, a Sensitivity of 87% and an Area under the curve of 0.92. This model was adjusted exclusively to the miRNA and tumor type data of our cohort of 32 cancer patients (Figure 4).
    Invasion
    A firm of 4 microRNAs composed of miR-17, -214, -122 and -148 generated ratios
    10 that were differentially expressed significantly between the invasiveness or not of the tumor (Table 4):
    Table 4. Mean and SEM of the differentially expressed microRNA ratios between tumor invasiveness or not
    miR Ratios (Log2) No Invasion (Mean ± SEM)Invasion (Mean ± SEM)P
    miR-17 / miR-214 17.1 ± 212.1 ± 1.10.04
    miR-122 / miR-148 14.5 ± 2.819.4 ± 1.70.05
    miR-214 / miR-148 -3.1 ± 0.92.5 ± 2.10.02
    15 The combination model of these ratios allowed to discriminate the invasiveness or not of the tumor with a Specificity of 91%, a Sensitivity of 64% and an Area under the curve of 0.85. This model was adjusted exclusively to the microRNA and tumor invasiveness data of our cohort of 32 cancer patients (Figure 5).


    Metastasis
    A signature of 5 microRNAs composed of miR-17, -214, -122, -29b and -30 generated ratios that were differentially expressed significantly between the presence or not of metastasis (Table 5):
    Table 5. Means and SEM of the ratios of differentially expressed microRNAs between the presence or absence of metastases.
    miR Ratios (Log2) No Metastasis (Mean ± SEM)Metastasis (Mean ± SEM)P
    miR-17 / miR-214 16.1 ± 1.610.3 ± 2.20.04
    miR-122 / miR-214 18.8 ± 1.613 ± 2.20.05
    miR-29b / miR-214 23.6 ± 1.117.1 ± 20.02
    miR-214 / miR-30 -16 ± 1.6-10.3 ± 2.30.02
    The combination model of these ratios allowed to discriminate the presence or not of metastases with a Specificity of 75%, a Sensitivity of 71% and an Area under the curve of 0.78. This model was adjusted exclusively to the microRNA and metastasis data of our cohort of 32 cancer patients.
    Stadium
    A signature of 3 microRNAs composed of miR-29b, -214, and -372 generated ratios that were differentially expressed significantly between the presence or absence of 15 metastases (Table 6):
    Table 6. Means and SEM of the ratios of differentially expressed microRNAs between stage 3 and 4 of the tumor
    miR Ratios (Log2) Stage 3 (Mean ±Stage 4 (Mean ±P
    SEM)SEM)
    miR-29b / miR-214 25.4 ± 0.8919.2 ± 1.730.00
    miR-214 / miR-372 -3.9 ± 1.82.07 ± 2.30.03
    The combination model of these ratios allowed discriminating between stage 3 and 4 of the 20 tumor with a Specificity of 72%, a Sensitivity of 78% and an Area under the curve of


    0.84. This model was adjusted exclusively to the microRNA and tumor stage data of our cohort of 32 cancer patients.

    权利要求:
    Claims (11)
    [1]
    1.-Simultaneous use of microRNA biomarkers: miR-146a, miR-122, miR148a, miR-214, miR-372, miR-let7c, miR-30c, miR-19a, miR-193b, miR-29b and miR -17 for the diagnosis, classification and / or monitoring of lung cancer.
    [2]
    2.-A method of obtaining useful data for the diagnosis, classification and / or monitoring of an individual or subject that potentially suffers from lung cancer, which comprises:
    a) quantify the expression product of the biomarkers miR-146a, miR122, miR-148a, miR-214, miR-372, miR-let7c, miR-30c, miR-19a, miR-193b, miR-29b and / or miR-17 in a biological sample isolated from said individual.
    [3]
    3. The method according to the preceding claim, further comprising:
    b) calculate the index A according to the equation: A = -0.083 + 0.172 * (miR-122 / miR-29b) + 0.009 * (miR-29b / miR-146) -0.038 * (miR214 / miR-146) -0.041 * (miR-193 / miR-146) + 0.004 * (miR-30 / miR-146) + 0.056 * (miR146 / miR-372),
    c) calculate the index B according to the equation: B = 3,793 -0,501 * (miR-17 / miR-148) + 0.167 * (miR-29b / miR-Letc7c) + 0.278 * (miR214 / miR-Let7c) -0.045 * (miR-148 / miR-let7c),
    d) calculate the C index according to the equation: C = 1.417 -0.139 * (miR-17 / miR-214) + 0.05 * (miR-122 / miR-148) + 0.106 * (miR-214 / miR148),
    e) calculate the index D according to the equation:
    D = 4,372 -0,026 * (miR-17 / miR-214) -0,049 * (miR-122 / miR-214) -0,129 * (miR-29b / miR214) + 0,022 * (miR-214 / miR-30) and /or
    f) calculate the E index according to the equation: E = 16,12 -0,630 * (miR-29b / miR-214) + 0.157 * (miR-214 / miR-30),

    assigning in each equation the values of the corresponding biomarkers obtained in step (a).
    [4]
    4. A method for the classification, diagnosis and monitoring of lung cancer comprising steps (a) and (b) according to any of claims 2-3, and further comprising:
    g) classify the individual of step (a) in the group of individuals with lung cancer when the value of the index A of step (b) is preferably less than 0.88, more preferably less than 0.75, and even more preferably less than 0.579.
    [5]
    5. A method for the classification, diagnosis and monitoring of lung cancer comprising steps (a) and (c) according to any of claims 2-3, and further comprising:
    h) classify the individual from step (a) in the group of individuals with non-small cell lung cancer of the adenocarcinoma and non-epidermoid type when the B index value of step (c) is preferably less than 0.91, more preferably less than 0.72, and even more preferably less than 0.50.
    [6]
    6. A method for the classification, diagnosis and monitoring of lung cancer comprising steps (a) and (d) according to any of claims 2-3, and further comprising:
    i) classify the individual from step (a) in the group of individuals with invasive tumor lung cancer when the C index value of step (d) is preferably greater than 0.30, more preferably greater than 0.39, and even more preferably greater than 0.65.
    [7]
    7. A method for the classification, diagnosis and monitoring of lung cancer comprising steps (a) and (e) according to any of claims 2-3, and further comprising:
    j) classify the individual from step (a) in the group of individuals with lung cancer with metastasis when the D index value of step (e) is preferably greater than 0.28, more preferably greater than 0.34, and still more preferably greater than 0.45.
    [8]
    8. A method for the classification, diagnosis and monitoring of lung cancer comprising steps (a) and (f) according to any of claims 2-3, and further comprising:

    k) classify the individual of step (a) in the group of individuals with stage 4 lung cancer when the value of the E index of step (f) is preferably greater than 0.18, more preferably greater than 0.39, and even more preferably greater than 0.64.
    [9]
    9. The method according to any of claims 2-8, wherein the biological sample isolated from step (a) is a condensate sample of exhaled air.
    [10]
    10. A kit or device according to the preceding claim, comprising primers, probes and / or antibodies capable of quantifying the microRNA expression product: miR-146a, miR-122, miR-148a, miR-214, miR-372 , miR-let7c, miR-30c, miR-19a, miR193b, miR-29b and miR-17, and where:
    - primers or primers are polynucleotide sequences of between 10 and 30 base pairs, more preferably between 15 and 25 base pairs, even more preferably between 18 and 22 base pairs, and even more preferably about 20 pairs of bases, which have an identity of at least 80%, more preferably of at least 90%, even more preferably of at least 95%, still much more preferably of at least 98%, and particularly of 100% , with a fragment of the sequences complementary to SEQ ID No.: 1, SEQ ID No.: 2, SEQ ID No.: 3, SEQ ID No.: 4, SEQ ID No.: 5, SEQ ID No.: 6, SEQ ID No.: 7, SEQ ID No.: 8, SEQ ID No.: 9, SEQ ID No.: 10, SEQ ID No.: 11, SEQ ID No.: 12, SEQ ID No.: 13, SEQ ID No.: 14, SEQ ID No.: 15, SEQ ID No.: 16, SEQ ID No.: 17, SEQ ID No.: 18, SEQ ID No.: 19, SEQ ID No.: 20, SEQ ID No.: 21, SEQ ID No.: 22 and / or SEQ ID No.: 23.
    - the probes are polynucleotide sequences of between 80 and 1100 base pairs, more preferably between 100 and 1000 base pairs, and even more preferably between 200 and 500 base pairs, which have an identity of at least 80%, more preferably at least 90%, even more preferably at least 95%, even more preferably at least 98%, and particularly 100%, with a fragment of the sequences complementary to SEQ ID NO: 1, SEQ ID Nº: 2, SEQ ID Nº: 3, SEQ ID Nº: 4, SEQ ID Nº: 5, SEQ ID Nº: 6, SEQ ID Nº: 7, SEQ ID Nº: 8, SEQ ID Nº: 9, SEQ ID No.: 10, SEQ ID No.: 11, SEQ ID No.: 12, SEQ ID No.: 13, SEQ ID No.: 14, SEQ ID No.: 15, SEQ ID No.: 16, SEQ ID No.: 17, SEQ ID Nº: 18, SEQ ID Nº: 19, SEQ ID Nº: 20, SEQ ID Nº: 21, SEQ ID Nº: 22 and / or SEQ ID Nº: 23.
    - The antibodies are capable of binding to a region formed by any of the nucleotide sequences SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID Nº: 7, SEQ ID Nº: 8, SEQ ID Nº: 9, SEQ ID Nº:

    10, SEQ ID No.: 11, SEQ ID No.: 12, SEQ ID No.: 13, SEQ ID No.: 14, SEQ ID No.: 15, SEQ ID No.: 16, SEQ ID No.: 17, SEQ ID No.: 18, SEQ ID No.: 19, SEQ ID No.: 20, SEQ ID No.: 21, SEQ ID No.: 22 and / or SEQ ID No.: 23.
    [11]
    11.- A microarray comprising oligonucleotides or single channel microarrays
    5 designed from the nucleotide sequences SEQ ID No.: 1, SEQ ID No.: 2, SEQ ID No.: 3, SEQ ID No.: 4, SEQ ID No.: 5, SEQ ID No.: 6, SEQ ID No.: 7, SEQ ID No.: 8, SEQ ID No.: 9, SEQ ID No.: 10, SEQ ID No.: 11, SEQ ID No.: 12, SEQ ID No.: 13, SEQ ID No.: 14, SEQ ID No.: 15, SEQ ID Nº: 16, SEQ ID Nº: 17, SEQ ID Nº: 18, SEQ ID Nº: 19, SEQ ID Nº: 20, SEQ ID Nº: 21, SEQ ID Nº: 22 and / or SEQ ID Nº: 23.
    12. 12. Use of the kit or device as defined in claim 10 or of a microarray as defined in claim 11, for obtaining useful data for the diagnosis, classification and / or monitoring of an individual or subject potentially suffering from lung cancer.

    Fig. 1

    Fig. 2

     Fig. 3

    Fig. 4

    Fig. 5

    Fig. 6

    Fig. 7

    <110> ANDALUSIAN HEALTH SERVICE
    UNIVERSITY OF CORDOBA
    <120> MicroRNAs as biomarkers for the diagnosis of cancer
    lung
    <130> FIBICO-15011
    <160> 2. 3
    <170> PatentIn version 3.5
    <210> one
    <211> 99
    <212> DNA
    <213> Homo sapiens
    <400> one
    ccgatgtgta tcctcagctt tgagaactga attccatggg ttgtgtcagt gtcagacctc tgaaattcag ttcttcagct gggatatctc tgtcatcgt
    99
    <210> 2
    <211>  85
    <212> DNA
    <213> Homo sapiens
    <400> 2
    ccttagcaga gctgtggagt gtgacaatgg tgtttgtgtc taaactatca aacgccatta 60
    tcacactaaa tagctactgc taggc 85
    <210> 3
    <211> 68
    <212> DNA
    <213> Homo sapiens
    <400> 3 gaggcaaagt tctgagacac tccgactctg agtatgatag aagtcagtgc actacagaac 60
    tttgtctc
    68
    <210> 4
    <211> 110
    <212> DNA
    <213> Homo sapiens

    <400> 4 ggcctggctg gacagagttg tcatgtgtct gcctgtctac acttgctgtg cagaacatcc 60
    gctcacctgt acagcaggca cagacaggca gtcacatgac aacccagcct 110
    <210> 5
    <211> 67
    <212> DNA
    <213> Homo sapiens
    <400> 5 gtgggcctca aatgtggagc actattctga tgtccaagtg gaaagtgctg cgacatttga 60
    gcgtcac 67
    <210> 6
    <211> 84
    <212> DNA
    <213> Homo sapiens
    <400> 6 gcatccgggt tgaggtagta ggttgtatgg tttagagtta caccctggga gttaactgta 60
    caaccttcta gctttccttg gagc 84
    <210> 7
    <211> 89
    <212> DNA
    <213> Homo sapiens
    <400> 7 accatgctgt agtgtgtgta aacatcctac actctcagct gtgagctcaa ggtggctggg 60
    agagggttgt ttactccttc tgccatgga 89
    <210> 8
    <211> 72
    <212> DNA
    <213> Homo sapiens
    <400> 8 agatactgta aacatcctac actctcagct gtggaaagta agaaagctgg gagaaggctg 60
    tttactcttt ct 72

    <210> 9
    <211> 82
    <212> DNA
    <213> Homo sapiens
    <400> 9 gcagtcctct gttagttttg catagttgca ctacaagaag aatgtagttg tgcaaatcta 60
    tgcaaaactg atggtggcct gc 82
    <210> 10
    <211> 83
    <212> DNA
    <213> Homo sapiens
    <400> 10 gtggtctcag aatcggggtt ttgagggcga gatgagttta tgttttatcc aactggccct 60
    caaagtcccg cttttggggt cat 83
    <210> 11
    <211> 81
    <212> DNA
    <213> Homo sapiens
    <400> 11 cttcaggaag ctggtttcat atggtggttt agatttaaat agtgattgtc tagcaccatt 60
    tgaaatcagt gttcttgggg g 81
    <210> 12
    <211> 84
    <212> DNA
    <213> Homo sapiens
    <400> 12 gtcagaataa tgtcaaagtg cttacagtgc aggtagtgat atgtgcatct actgcagtga 60
    aggcacttgt agcattatgg tgac 84
    <210> 13
    <211> 22
    <212> RNA
    <213> Homo sapiens

    <400> 13 ugagaacuga auuccauggg uu
    <210> 14
    <211> 22
    <212> RNA
    <213> Homo sapiens
    <400> 14 uggaguguga caaugguguu ug 22
    <210> 15
    <211> 22
    <212> RNA
    <213> Homo sapiens
    <400> 15 ucagugcacu acagaacuuu gu 22
    <210> 16
    <211> 22
    <212> RNA
    <213> Homo sapiens
    <400> 16 acagcaggca cagacaggca gu 22
    <210> 17
    <211> 23
    <212> RNA
    <213> Homo sapiens
    <400> 17 ccucaaaugu ggagcacuau ucu 23
    <210> 18
    <211> 22
    <212> RNA
    <213> Homo sapiens
    <400> 18 ugagguagua gguuguaugg uu 22
    <210> 19
    <211> 23

    <212> RNA
    <213> Homo sapiens
    <400> 19 uguaaacauc cuacacucuc agc 23
    <210> 20
    <211> 22
    <212> RNA
    <213> Homo sapiens
    <400> 20 aguuuugcau aguugcacua ca 22
    <210> 21
    <211> 22
    <212> RNA
    <213> Homo sapiens
    <400> 21 cgggguuuug agggcgagau ga 22
    <210> 22
    <211> 23
    <212> RNA
    <213> Homo sapiens
    <400> 22 uagcaccauu ugaaaucagu guu 23
    <210> 23
    <211> 23
    <212> RNA
    <213> Homo sapiens
    <400> 23 caaagugcuu acagugcagg uag 23
    类似技术:
    公开号 | 公开日 | 专利标题
    Wang et al.2014|Combined detection of serum exosomal miR-21 and HOTAIR as diagnostic and prognostic biomarkers for laryngeal squamous cell carcinoma
    JP2020188787A|2020-11-26|Pancreatic cancer detection kit or device, and detection method
    US10011835B2|2018-07-03|miRNAs as novel therapeutic targets and diagnostic biomarkers for parkinson&#39;s disease
    ES2688693T3|2018-11-06|Plasma microRNAs for the detection of incipient colorectal cancer
    Wang et al.2015|Early detection of lung cancer in serum by a panel of microRNA biomarkers
    US9410206B2|2016-08-09|Long noncoding RNA | as a biomarker and therapeutic marker in cancer
    KR20170015509A|2017-02-08|Detection kit or device and detection method for biliary tract cancer
    JP2010510769A|2010-04-08|Methods and compositions for diagnosis of esophageal cancer and prognosis and improvement of patient survival
    JPWO2015194535A1|2017-04-20|Gastric cancer detection kit or device and detection method
    AU2018202963A1|2018-05-17|Biomarkers useful for detection of types, grades and stages of human breast cancer
    KR20200019849A|2020-02-25|Kits, Devices, and Methods for Detection of Lung Cancer
    CN109182521A|2019-01-11|Application of the circRNA as thyroid papillary carcinoma marker
    ES2646826B1|2018-10-01|MicroRNAs as biomarkers for the diagnosis of lung cancer
    CN108165546A|2018-06-15|A kind of miRNA biomarker, composition and application thereof
    EP2942399B1|2017-03-08|Method for the diagnosis of breast cancer
    CN110055332A|2019-07-26|Marker relevant to thyroid cancer and its application
    TW201514311A|2015-04-16|Method for determining the prognosis of pancreatic cancer
    ES2481819B1|2015-04-01|ASSESSMENT METHOD TO EVALUATE A POSSIBILITY OF BREAST CANCER
    ES2648638B1|2018-10-09|Circulating microRNAs as biomarkers of Primary Antiphospholipid Syndrome
    Brajušković et al.2017|Genetic basis of prostate cancer: Association studies
    JP2011072229A|2011-04-14|Method for performing diagnosis/choice of treatment of hypopharynx cancer by using microrna as biomarker
    US9932640B1|2018-04-03|Clinical use of an Alu element based bioinformatics methodology for the detection and treatment of cancer
    同族专利:
    公开号 | 公开日
    ES2646826B1|2018-10-01|
    WO2017194814A1|2017-11-16|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    CN101400361B|2006-01-05|2012-10-17|俄亥俄州立大学研究基金会|Microrna-based methods and compositions for the diagnosis, prognosis and treatment of lung cancer|
    EP2470897A4|2009-08-28|2013-05-29|Asuragen Inc|Mirna biomarkers of lung disease|
    WO2013116503A2|2012-02-02|2013-08-08|Albert Einstein College Of Medicine Of Yeshiva University|Exhaled nucleic acid detection for non-invasive assessment of the lung|
    US20140038194A1|2012-08-03|2014-02-06|The Curators Of The University Of Missouri|Method For Early Detection of Lung Cancer|
    法律状态:
    2018-10-01| FG2A| Definitive protection|Ref document number: 2646826 Country of ref document: ES Kind code of ref document: B1 Effective date: 20181001 |
    优先权:
    申请号 | 申请日 | 专利标题
    ES201630628A|ES2646826B1|2016-05-13|2016-05-13|MicroRNAs as biomarkers for the diagnosis of lung cancer|ES201630628A| ES2646826B1|2016-05-13|2016-05-13|MicroRNAs as biomarkers for the diagnosis of lung cancer|
    PCT/ES2017/070307| WO2017194814A1|2016-05-13|2017-05-12|Micro-rnas as biomarkers for the diagnosis of lung cancer|
    [返回顶部]